Грунтовки: Грунтовка интерьерная Ceresit IN-10 5 л

Содержание

Для чего нужно грунтовать и какие виды грунтовки бывают

В данной статье мы расскажем о видах строительных грунтовок, как их выбирать и зачем необходимо грунтовать основание. Начнем по порядку.

Что такое грунтовка?

Грунтовка — это состав, в большинстве случаев жидкий, предназначенный для нанесения на основание с целью подготовки его для дальнейшего нанесения последующих слоев строительных материалов.

Какие виды строительных грунтовок встречаются?

Существует большой ассортимент грунтовочных составов, для любых задач и сфер применения. В основном простому обывателю, сталкивающемуся с ремонтными или отделочными работами, знакомы жидкие грунтовки на водной основе. Также на рынке строительных материалов встречаются грунтовки на основе органических растворителей и даже в виде сухих смесей, растворяемых в воде.

1. Жидкие грунтовки на водной основе

Данная группа грунтовочных составов в своей основе содержит полимерную дисперсию (латекс), которая выступает в роли связующего.

Также в основе могут содержаться противогрибковые добавки, пигменты, разного рода наполнители и другие компоненты способные придать составу дополнительные свойства.

2. Жидкие грунтовки на основе органических растворителей

Основным отличием данной группы является наличие в составе связующего, для разбавления которого пригодны только органические растворители такие как сольвент, уайт-спирит и тому подобное. Конечно же помимо связующего и растворителя в данных грунтовках могут содержаться и иные добавки, придающие составу дополнительный функционал.

3. Сухие грунтовки

В отличие от предыдущих групп данные материалы имеют изначальное состояние сухого порошка, который непосредственно перед применением размешивается с водой. В составе данных материалов содержится как минимум одно связующее, разного рода наполнители, а также функциональные добавки, позволяющие придать составу необходимые свойства.

Итак, после того как мы узнали какие основные виды грунтовок встречаются мы можем более детально поговорить о процессе выбора того или иного грунтовочного состава.

Какие задачи могут выполнять грунтовки?

Грунтовочные составы в первую очередь требуются для повышения качества сцепления слоя строительного материала с основанием, снижение риска растрескивания или отслоения отделочного слоя, снижение расхода лакокрасочных материалов, а также в некоторых случаях повышение прочности обрабатываемой поверхности. Так же производители грунтовок закладывают в них такие свойства как защита от грибков и плесени. Некоторые составы могут придать поверхности антистатичность или стойкость к коррозии.

Как правильно выбрать грунтовку?

На самом деле все не так сложно, как может показаться на первый взгляд. Достаточно просто посмотреть на те работы, которые необходимо выполнить.
Итак, условно работы можно разделить на общестроительные и специальные.

Специальные ремонтно-строительные работы

Это восстановление или усиление несущей способности конструкции и сооружения, нанесение материалов, существенно повышающих такие свойства как химическая стойкость, антистатичность, токопроводность, водонепроницаемость и т.п. Также специальные работы отличаются тем, что требуют от строителей более высокой квалификации, так как неправильно выполненная работа может повлечь за собой серьезные последствия или убытки.

Общестроительные работы

В данную группу можно отнести отделочные работы, шпаклевание, оштукатуривание, окраска, устройство напольных покрытий, облицовка и т.п. Также к ним можно отнести те работы, в результате которых выполняется восстановление защитного слоя или декоративного вида.

Пример 1

Весьма распространенной задачей будет оштукатуривание основания, выполненного из газобетонных блоков внутри помещения.


Так как газоблоки являются строительным материалом сильно впитывающей структурой, то обязательным условием является снижение впитываемости данного основания. Так что в данном случае необходимо подобрать грунтовку, которая обеспечит нормализацию впитываемости основания. Для этой задачи подойдет простая грунтовка на водной основе, в качестве связующего в которой будет водная дисперсия полимеров (латекс).
В случае выполнения аналогичных работ, но уже вне помещения необходимо обратить внимание на то, чтобы грунтовка была для наружных работ.

Пример 2

В данном примере рассмотрим задачу, в которой также необходимо оштукатурить поверхность внутри помещения, но уже материалом, из которого оно выполнено будет плотный железобетон. Первое на что следует обратить внимание это насколько высокая впитываемость или, иными словами, водопоглащение бетона, а поможет нам в этом обычная вода. Для определения впитываемости необходимо смочить небольшой участок основания водой и посмотреть насколько быстро она впитается в него.

На слабовпитывающем основание след от воды будет иметь характерный блеск на протяжение нескольких минут, на основании с нормальным впитыванием блеск практически сразу исчезает.
После того как мы определили насколько сильно впитывает основание, можно легко выбрать тип грунтовки. Для оснований, имеющих очень низкое водопоглащение необходимо использовать грунтовочные составы на водной основе, содержащих в своем составе наполнитель повышающий адгезию к обработанной поверхности. Для оснований с нормальным водопоглащением наиболее подходящим будет обычная грунтовка.
В случае выполнения аналогичных работ, но уже вне помещения также, как и в предыдущем примере необходимо использовать составы, рекомендованные для наружного применения.

Пример 3

В данном примере рассмотрим не менее распространенный случай, в котором требуется отшпаклевать стену, которая оштукатурена цементно-известковой штукатуркой. Основной особенностью данного примера является штукатурный слой, который помимо высокого водопоглащения, имеет сниженную в результате его эксплуатации прочность.

Отталкиваясь от данных особенностей, можно сделать вывод, что перед началом шпаклевания необходимо нормализовать водопоглащение основания и повысить его прочность. Для этого наиболее оптимальным решением будет применение в качестве грунтовки продукта способного глубоко проникнуть в подобного рода структуру, тем самым произвести укрепление штукатурного слоя, нормализовав его водопоглащение.

Резюмируя вышесказанное можно сделать следующие рекомендации:

  1. Обычные грунтовки на водной основе рекомендованы для обработки оснований, выполненных из таких материалов, как:
    • керамический и силикатный кирпич;
    • цементные и гипсовые штукатурки;
    • керамические, газобетонные, керамзитобетонные и другие блоки на минеральной основе.
  2. Грунтовки на водной основе глубокого проникновения рекомендованы для обработки оснований, выполненных из материалов, имеющих рыхлую структуру, требующих ее укрепления, при шпаклевании и при напольных работах с применением наливного пола.
    Пример оснований:
    • старые цементно-известковые штукатурки;
    • облегченные и теплоизоляционные штукатурки;
    • цементные и гипсовые шпаклевки;
    • цементные стяжки, в том числе полусухие.
  3. Грунтовки на водной основе, имеющие в своем составе наполнитель, типа бетонконтакт, рекомендованы для обработки оснований, выполненных из материалов, имеющих слабо впитывающую или очень плотную структуру;
    • бетон и железобетон;
    • ЦСП, ДСП, ДВП, ОСП.
  4. Грунтовки на водной основе с наличием в составе противогрибковых добавок рекомендованы для обработки поверхностей в помещениях с высокой влажностью и высоким риском появления грибков.
  5. Грунтовочные материалы на основе органических растворителей применяются при выполнении специальных работ. Как правило производители строительных материалов, для которых необходимо выполнять грунтовочные работы с применением данного вида грунтовок, прописывают тип и даже конкретное наименование материала с целью обеспечения всех условий необходимых для получения качественного результата. Также в случае необходимости применения специализированных материалов их вид и характеристики указываются в проектной документации.
  6. Сухие грунтовки как правило применяются при выполнении специализированных работ, таких как ремонт конструкций и сооружений. И в этом случае рекомендации по применению и выбору грунтовки будут предоставлены производителем материала, для которого необходимо подготовить основание или указаны в проектной документации на объект.

Понравилась статья?

Поделиться в соцсетях:

для стен и потолка под обои и покраску.

Нужно покрасить?
Возьми текс!

Где вы находитесь?

Москва Санкт-Петербург Екатеринбург Нижний Новгород Краснодар Новосибирск Иркутск Красноярск Казань Пермь Челябинск Самара




Грунтовка глубокого проникновения 2-в-1 Универсал Для грунтования поверхностей внутри и снаружи помещений, перед окраской водно-дисперсионными красками, шпатлеванием, облицовкой плиткой.

С апреля 2016 года Грунтовка Пропиточная Универсал выпускается в новом дизайне под названием Грунтовка Глубокого проникновения 2-в-1 Универсал.



Грунтовка бетон-контакт Универсал Грунтовка адгезионная акрилатная для внутренних и наружных работ, образует шероховатую поверхность, улучшает сцепление отделочных материалов с гладкими основаниями.

Пошаговый подбор краски

Грунтовки и шпатлевки Finncolor для интерьеров и фасадов

Грунтовки бренда Finncolor используют для подготовки поверхности к окрашиванию и оклейке обоями. Специальные составы улучшают адгезию и сокращают расход лакокрасочного материала.

Шпатлевка Finnfiller используется для полного или частичного выравнивания поверхности. Она рекомендуется к применению в системе с грунтовками Finncolor, а также интерьерными красками из линейки Oasis.

Шпатлевка FinnFiller FinnFiller – универсальная мелкозернистая финишная шпатлевка. Предназначена для полного и частичного выравнивания гипсовых, гипсокартонных плит с использованием шовной ленты, ДВП, бетонных, пенобетонных, газобетонных, кирпичных, оштукатуренных поверхностей в сухих помещениях. Применяется в системе с грунтовкой Moraine Strong и интерьерными красками Oasis Super White, Oasis Interior, Oasis Interior Plus, Oasis Hall&Office, Oasis Kitchen&Gallery. Грунтовка укрепляющая Moraine strong Грунтовка укрепляющая Moraine Strong (концентрат 1:3) предназначена для пропитки поверхностей внутри помещений с целью их укрепления перед нанесением водно-дисперсионных красок и перед оклейкой обоями. Грунтовка содержит добавки против грибка и плесени.

Грунтовки Finncolor на водной основе делятся на следующие виды:

  • составы для внутренних работ. Они наносятся ровным слоем на минеральные и деревянные поверхности: полы, стены и потолки. Если основа пористая, грунт рекомендуется наносить перед применением шпатлевки. В других случаях его используют перед финишным окрашиванием или оклейкой обоями.
  • укрепляющие составы для бетона при наружных работах. Для отделки фасадов зданий применяют акриловую грунтовку глубокого проникновения. При нанесении на минеральные поверхности она создает дышащий слой, препятствующий образованию плесени и грибка.

Профессионалы выбирают грунтовки и шпатлевки Finncolor не только из-за стоимости и гарантированного качества, но и за функциональность и надежность решений для наружной и внутренней отделки здания. Перечень строительных магазинов, в которых можно приобрести продукцию бренда, указан в разделе «Где купить». Цены уточняйте в местах продаж.

Грунтование. Как правильно выбрать грунтовку

Ленинградская область

Санкт-Петербург

Бокситогорск

Васкелово

Волосово

Волхов

Всеволожск

Выборг

Выра

Вырица

Гатчина

Грузино

Дранишники

Заполье

Зеленогорск

Кингисепп

Кириши

Кировск

Колпино

Колтуши

Коммунар

Лодейное поле

Ломоносов

Лосево

Луга

Мичуринское

Мурино

Ново-Токсово

Отрадное

Павлово

Песочный

Пикалево

Приозерск

Псков

Романовка

Ропша

Рощино

Сестрорецк

Сиверский

Сланцы

Сосново

Сосновый Бор

Тихвин

Токсово

Тосно

Ульяновка

Черемыкино

Москва и Московская область

Москва

Алтуфьево

Видное

Владимир

Дмитров

Дубино

Дубна

Егорьевск

Зеленоград

Иваново

Истра

Климовск

Клин

Коломна

Кострома

Красногорск

Кубинка

Лосино-Петровский

Люберцы

Меличкино

Можайск

Мытищи

Ногинск

Одинцово

Орехово-Зуево

п. Соболиха

Павловский Посад

пгт. Белоозерский

Подольск

Пушкино

Раменское

Сергиев Посад

Серпухов

Сокольники

Старая Купавна

Тарасовка

Химки

Хотьково

Шолохово

Шуя

Щелково

Электросталь

Юдино

Ям

Ярославль

Алтайский край

Барнаул

Амурская область

Благовещенск

Архангельская область

Архангельск

Новодвинск

Северодвинск

Брянская область

Брянск

Волгоградская область

Волгоград

Волжский

Вологодская область

Белозерск

Великий Устюг

Вологда

Воронеж

п. Кадуй

п. Шексна

Тотьма

Череповец

Воронежская область

Воронеж

Забайкальский край

Чита

Ивановская область

Иваново

Шуя

Иркутская область

Ангарск

Иркутск

Шелехов

Кабардино-Балкаарская Республика

Баксан

Нальчик

Калининградская область

Калининград

Калужская область

Кемеровская область

Кемерово

Новокузнецк

Кировская область

Киров

Кирово-Чепецк

Костромская область

Кострома

Краснодарский край

Адлер

Адыгея

Краснодар

Курганинск

Сочи

Красноярский край

Красноярск

Курганская область

Курган

Шадринск

Курская область

Курск

Мурманская область

Апатиты

Кандалакша

Мурманск

Нижегородская область

Нижний Новгород

Новгородская область

Боровичи

Великий Новгород

Старая Русса

Новосибирская область

Новосибирск

Омская область

Омск

Оренбургская область

Бузулук

Новотроицк

Оренбург

Орск

Пензенская область

Пенза

Пермский край

Пермь

Приморский край

Артем

Владивосток

Находка

Псковская область

Великие Луки

Псков

Республика Башкортостан

Бирск

Красноусольский

Кумертау

Нефтекамск

Октябрьский

Салават

Стерлитамак

Уфа

Республика Беларусь

Минск

Республика Бурятия

Улан-Удэ

Республика Дагестан

Махачкала

Республика Казахстан

Астана

Республика Карелия

Костомукша

Петрозаводск

Сегежа

Сортавала

Республика Коми

Сыктывкар

Республика Крым

Севастополь

Симферополь

Республика Мордовия

Саранск

Республика Татарстан

Казань

Набережные Челны

Республика Чувашия

Чебоксары

Ростовская область

Аксай

Батайск

г. Каменск-Шахтинский

Новочеркасск

Ростов-на-Дону

Рязанская область

Рязань

Самарская область

Кинель

п. Волжский (Царевщина)

п. Стройкерамика

Похвистнево

Самара

Тольятти

Ульяновск

Саратовская область

Саратов

Сахалинская область

Южно-Сахалинск

Свердловская область

Екатеринбург

Нижний Тагил

Ставропольский край

Михайловск

Невинномысск

Ставрополь

Тверская область

Тверь

Тульская область

Тула

Тюменская область

Тобольск

Тюмень

Ялуторовск

Ульяновская область

Ульяновск

Хабаровский край

Хабаровск

Ханты-Мансийский АО (Югра)

Лангепас

Мегион

Нефтеюганск

Нижневартовск

Сургут

Челябинская область

Челябинск

Читинская область

Чита

Ярославская область

Ярославль

Грунтовка под штукатурку — правила и способы нанесения.

— Farbe

Красивый, стильный интерьер квартиры или дома начинается со стен, а их отделка — с грунтовки.

Это обязательный и очень важный этап отделочных работ. Хотя многие относятся к этой процедуре несерьезно, ведь грунтовку и ее качество все рано никто не заметит под обоями или плиткой. Но такое отношение ошибочно. Часто именно грунтовка определяет качество отделочных работ и последующий внешний вид и эстетику помещения.

Функции грунтовки

  1. Грунтование требуется для того, чтобы устранить неровности стен или потолка. Даже у только что построенного дома не может быть идеально ровных и гладких стен. Почти все материалы (кирпич, полимерные блоки, бетонные плиты) шероховаты, на стыках кладки обязательно есть выступы или углубления, которые перед отделкой необходимо выровнять.
  2. Грунтовка усиливает адгезию, то есть сцепление отделочного материала с поверхностью стены. Например, виниловые обои достаточно тяжелые и плотные. Их крайне сложно клеить без предварительной грунтовки стен.
  3. Слой грунтовки порист и хорошо впитывает как клей, так и краску. Краска на грунтовку ложится ровнее, выглядит более ярко и держится дольше, а также не осыпается и не выцветает, так как впитывается в грунтовку. Это хорошо знают все художники, недаром они перед созданием картины грунтуют не только холст, но и картон.
  4. Грунтовка создает дополнительную гидроизоляцию и не позволяет влаге испортить отделочный материал. Сэкономив на грунтовке, можно потерять эффектность дорогих обоев.

Виды грунтовок

Выбор разнообразных грунтовочных составов и смесей велик. У них разные свойства и особенности, что позволяет подобрать именно ту грунтовку, которая необходима для конкретного материала стен: с высоким качеством, степенью надежности, долговечности и т. д.

Акриловые грунтовки наиболее универсальны. Они подходят практически для всех материалов. Ими можно грунтовать и бетон, и дерево, и гипсокартон. Единственное исключение — металлическая поверхность. Нанесение на нее акриловой грунтовки может привести к возникновению коррозии. Эти грунтовки достаточно глубоко проникают внутрь материала (до 1 см). Они идеально подходят под обои.

Глифталевая грунтовка предназначена именно для грунтования металлических поверхностей. Но у нее не слишком приятный запах, для выветривания которого требуется определенное время. Кроме этого, глифталевая грунтовка плохо переносит повышенную влажность. Алкидные грунтовки также применяют для металлических поверхностей, но они подходят и для дерева. Наилучший вариант для деревянной поверхности — это алюминиевые грунтовки. Они служат не только для выравнивания поверхности, но и обеззараживают ее, предохраняя древесину от гнили и грибка.

Шеллаковые грунтовки применяются преимущественно для грунтования деревянных поверхностей, так как они препятствуют выделению древесной смолы. Перхлорвиниловая грунтовка относится к разряду универсальных. Она годится для кирпичной кладки, бетонных плит и металлических поверхностей. Ее можно наносить даже на старую штукатурку. Единственное ограничение для использования этой грунтовки — дерево. Причем перхлорвиниловую грунтовка годится не только для внутренних, но и для наружных работ, так она хорошо переносит и жару, и холод, и любой уровень влажности.

Эпоксидные грунтовочные смеси используются в основном для бетона и металла. Они обеспечивают глубокую пропитку поверхностей и защиту от коррозии. Поливинилацетатные грунтовки относятся к специализированным, поскольку их наносят только под краску определенного состава.

Правила нанесения грунтовки

  1. Перед грунтованием поверхность стены следует подготовить, удалив старые обои, штукатурку и гвозди. Если на стене имеется плесень, то ее необходимо счистить и обработать место появления хлорной известью. В противном случае плесень появится снова на уже отремонтированной стене.
  2. Неровности, вмятины и сколы необходимо выровнять с помощью шпатлевки. Грунтовка наносится только после того, как шпатлевка полностью высохнет.
  3. Для нанесения грунтовки используют специальный грунтовочный валик или широкую малярную кисть. Сам процесс несложен и не требует специальных знаний и навыков, разве что аккуратности и внимательности. Грунтовочный состав наносится ровно и без пропусков, что крайне важно для равномерного покрытия всей поверхности стены или потолка.
  4. После того как нанесен первый слой грунтовки, необходимо дать стене просохнуть, а затем нанести следующий слой. Время, необходимое для высыхания грунтовки, как правило, указано на упаковке.
  5. Второй слой грунтовки также необходим, поскольку материал стены или потолка часто неоднородный. В результате на одних участках грунтовочная смесь впитывается лучше, чем на других. Второй слой сделает покрытие ровным, однородным и гладким.

Важно обратить внимание на следующий момент: если стены грунтуются под покраску, необходимо выбирать грунтовку белого цвета, иначе потом цвет краски изменится.

Для того чтобы поклеить обои, стена должна быть совершенно сухой, поэтому требуется большее время для высыхания грунтовки, обычно — сутки.

Где применяются грунтовки глубокого проникновения?

Задав любому профессиональному строителю вопрос: «Можно ли сделать ремонт без использования грунтовки?», вы получите однозначный отрицательный ответ. Грунтовка глубокого проникновения улучшает свойства различных поверхностей, поэтому специалисты-отделочники обрабатывают ею практически все: только их применение дает гарантию, что поклеенные обои, нанесенная штукатурка и уложенный кафель не начнут отслаиваться и осыпаться после ремонта. Давайте выясним, что же собой представляет эта строительная «палочка-выручалочка».

Грунтовка глубокого проникновения: состав

Нанесение грунтовки глубокого проникновения осуществляется обычной кистью или валиком

Прообраз грунтовки строители начали использовать задолго до ее появления на рынке. Это была самодельная смесь на основе клея ПВА. Информацию о том, как ее самостоятельно приготовить в домашних условиях, можно встретить в интернете и сегодня, причем авторы «рецепта» утверждают, что самодельная грунтовка не только полностью заменит фабричный аналог, но при этом потребует от вас минимальных капиталовложений. Поспешим развеять это миф. Современные грунтовки глубокого проникновения представляют собой высокотехнологический состав, в который входят:

  • Полимеры синтетических смол;
  • Модификаторы;
  • Вода.

Кроме того, грунтовки нового поколения, такие как «Акрилит-06», имеют в своем составе антисептики, препятствующие развитию грибка и плесени. Как видите, чтобы воссоздать фабричную грунтовку в домашних условиях, одним клеем ПВА не обойтись, для этого потребуется целая химическая лаборатория.

Грунтовка глубокого проникновения: область применения

Универсальная грунтовка глубокого проникновения относится к составам широкого спектра применения. Она подходит как для внешних, так и для внутренних работ, ее используют для обработки различных материалов, таких как:

  • Штукатурка;
  • Кирпич;
  • Гипс;
  • Газобетон;
  • Гипсокартон;
  • Пенобетон и т. д.

Грунтование поверхностей является обязательным этапом перед покраской, облицовкой керамической плиткой, нанесением декоративной штукатурки и другими вариантами финишной отделки. Главное назначение грунтовки глубокого проникновения заключается в укреплении и защите от влаги обрабатываемых оснований, поэтому она незаменима в процессе проведения ремонтных работ на поверхностях с избыточной пористостью и на старых рыхлых штукатурках. Глубоко проникая в слои материала, покрытие «связывает» его на молекулярном уровне, а также значительно снижает абсорбирующую способность основания, не создавая при этом препятствий для выхода излишков влаги.

Преимущества использования грунтовок глубокого проникновения

Современные качественные грунтовки защищают обрабатываемые поверхности от плесени и грибка

Грунтовки можно смело назвать уникальным материалом, они обладают множеством неоспоримых преимуществ, а именно:

  • Увеличивают адгезию слоев отделочных материалов;
  • Поглощают пыль;
  • Повышают износостойкость поверхностей;
  • Препятствуют образованию трещин;
  • Уменьшают впитывающую способность обрабатываемых покрытий, вследствие чего снижается расход краски;
  • Выравнивают поверхность и заполняют микротрещины;
  • Являются нетоксичным, экологически чистым продуктом, абсолютно безопасным для здоровья человека.

Технология применения грунтовочных составов

Еще один неоспоримый плюс грунтовок — это достаточная простота их применения: даже если вы, мягко говоря, далеки от строительства, вам вполне удастся качественно прогрунтовать  (главное — соблюдать рекомендации производителей состава). Перед грунтованием поверхность необходимо очистить от грязи и пыли, снять с нее отслоения, обезжирить, при необходимости подсушить. Грунтовку наносят полиамидным валиком с ворсом средней длины или малярной кистью. Не рекомендуется делать длительный перерыв между грунтованием и следующим этапом работ, так как за это время на обработанную поверхность осядет пыль, что значительно снизит качество последующей отделки.

Грунтовки для стен. ДЕКАРТ – производство и реализация лакокрасочных материалов

Сортировать по цене: по возрастаниюцене: по убываниюпозиции

Акриловая атмосферостойкая грунтовка применяется для грунтования перед окрашиванием или шпатлеванием фасадов, цоколей, стен и потолков снаружи и внутри помещений. Наносится на бетонные, кирпичные, оштукатуренные, зашпатлёванные и другие впитывающие минеральные основания. Укрепляет поверхность, снижает и выравнивает впитывающую способность основания. Уменьшает расход крас­ки, увеличивает адгезию.

Бесцветный грунт-влагоизолятор для защиты стен от влаги, сырости и протечек. Применяется для грунтования перед окраской, оклейкой обоев, укладкой плитки во влажных помещениях. Обеспечивает защиту от плесени до 10 лет. Обеспечивает защиту от влаги до 15 лет.

Акриловая универсальная грунтовка применяется для грунтования перед окрашиванием или шпатлеванием фасадов, цоколей, стен и потолков снаружи и внутри помещений. Наносится на бетонные, кирпичные, оштукатуренные, зашпатлёванные и другие впитывающие минеральные основания. Укрепляет поверхность, снижает и выравнивает впитывающую способность основания. Уменьшает расход крас­ки, увеличивает адгезию.

Адгезионный грунт с кварцевыми частицами для обработки гладких поверхностей перед нанесением декоративных штукатурок, настенной плитки снаружи и внутри помещений. Образует шероховатую поверхность, предотваращает сползание тяжелых покрытий. Оптимально подобранный по размеру кварцевый наполнитель. Очень хорошая адгезия. Высокая паропроницаемость

Акриловая универсальная грунтовка применяется для грунтования перед окрашиванием или шпатлеванием фасадов, цоколей, стен и потолков снаружи и внутри помещений. Наносится на бетонные, кирпичные, оштукатуренные, зашпатлёванные и другие впитывающие минеральные основания. Укрепляет поверхность, снижает и выравнивает впитывающую способность основания. Уменьшает расход крас­ки, увеличивает адгезию.

Акриловая грунтовка глубокого проникновения ВДАК-0181М для грунтования стен и потолков внутри помещений. Наносится на бетонные, кирпичные, оштукатуренные, зашпатлеванные минеральные основания. Интерьерная грунтовка обеспечивает оптимальные условия для нанесения краски, уменьшает её расход, увеличивает адгезию.

Белый высокоукрывистый акриловый грунт применяется перед оклейкой обоями или окраской водно-дисперсионными красками стен внутри помещений. Устраняет просвечивание основы через светлые обои. Скрывает пятна и неоднородный цвет поверхности. Наносится на бетонные, оштукатуренные, зашпатлеванные и ранее окрашенные водно-дисперсионными красками поверхности, гипсокартон, кирпич, цементные плиты, древесину, ДВП, ДСП

Адгезионный упрочняющий акриловый грунт для наружных и внутренних работ. Образует прочную и эластичную плёнку на поверхности. Связывает незакреплённые частицы материала и пыль. Обеспечивает опти­мальные условия для нанесения финишного покрытия. Уменьшает расход и увеличивает ­адгезию к основанию.

Акриловый грунт для минеральных поверхностей снаружи и внутри помещений. Изолирует следы от протечек и бытовых загрязнений, препятствуя их проявлению на поверхности после окрашивания. Увеличивает долговечность финишного покрытия. Повышает влагостойкость и атмосферостойкость покрытия.

Антикапиллярный глубокопроникающий акриловый грунт для минеральных поверхностей для наружных и внутренних работ. Глубоко пропитывает верхний слой окрашиваемой поверхности. Закрывает капилляры, выравнивает впитывающую способность. Обеспечивает оптимальные условия для нанесения финишного покрытия. Уменьшает расход и увеличивает ­адгезию к основанию.

Применяется для грунтования перед окрашиванием фасадов, цоколей, стен и потолков снаружи и внутри помещений. Наносится на пористые, бетонные, кирпичные, оштукатуренные, зашпатлеванные и другие минеральные основания. Образует эластичную пленку на поверхности, закрывая поры и закрепляя непрочные частицы и пыль. Обеспечивает высокую адгезию, снижает и выравнивает впитывающую способность основания, уменьшает расход краски.

Матовая 100 % акриловая краска премиум-класса для стен и потолков во всех типах помещений и фасадов. Для большинства минеральных поверхностей краска не требует предварительного грунтования, может применяться как высокоукрывистый грунт. Обладает антисептическими свойствами и создает покрытие, устойчивое к возникновению плесени. Сделана на основе современных сырьевых компонентов компании BASF.

Акриловый стабилизирующий грунт для наружных и внутренних работ. Связывает незакреплённые частицы материала и пыль на поверхности. Устраняет меление ранее окрашенных поверхностей. Снижает и выравнивает впитывающую способность пористых оснований. Обеспечивает оптимальные условия для нанесения краски, уменьшает её расход. Обеспечивает хорошую адгезию.

100% акриловый глубокопроникающий грунт премиум-класса для высококачественной подготовки к окраске стен и потолков снаружи и внутри помещений. Обеспечивает ­оптимальные условия и равномерность нанесения краски, снижает ее расход и увеличивает адгезию к окрашиваемой поверхности. Индикатор нанесения упрощает контроль качества работ. Сделана на основе современных сырьевых компонентов компании BASF.

Адгезионный грунт с кварцевыми частицами для обработки гладких поверхностей перед нанесением декоративных штукатурок, настенной плитки снаружи и внутри помещений. Образует шероховатую поверхность, предотваращает сползание тяжелых покрытий. Оптимально подобранный по размеру кварцевый наполнитель. Исключительно высокая адгезия. Высокая паропроницаемость.

Акриловый грунт глубокого проникновения для наружных и внутренних работ. Снижает и выравнивает впитывающую способность пористых минеральных оснований. Обеспечивает оптимальные условия для нанесения краски, уменьшает её расход. Обеспечивает хорошую адгезию.

Структурный грунт с кварцевыми частицами для предварительной обработки гладких поверхностей перед нанесением декоративных штукатурок. Образует шероховатую поверхность, предотваращает сползание тяжелых покрытий. Обеспечивает высокую адгезию. Выравнивает цвет основания. Не нарушает паропроницаемость.

Купить набор для перезарядки капсюлей и штампов и многое другое

Мы собрали матрицы и держатели гильз для трех популярных на сегодняшний день пистолетных патронов для стрельбы по мишеням и самообороны и трех самых популярных патронов для спортивных и охотничьих винтовок, а затем соединили их с одним компонентом, который труднее всего найти на современном рынке: капсюлями.

Независимо от того, являетесь ли вы опытным хэндлоадером, который хочет расширить свою текущую установку, или тем, кто хочет начать перезагрузку в первый раз и открыть для себя как экономию денег, так и повышенную точность, которые обеспечивает хобби, эти шесть комплектов* предлагают что-то для каждого.

  • Наборы пистолетного калибра включают легендарный набор из трех матриц RCBS: твердосплавные калибровочные, расширительные и посадочные матрицы, гильзодержатель соответствующего калибра и 1000 капсюлей CCI ** :
    • Комплект 9мм Luger включает капсюли Small Pistol
    • Комплект .40 S&W/10mm включает капсюли Small Pistol
    • Комплект .45 ACP/G.A.P./Auto Rim включает капсюли Large Pistol
  • Комплекты винтовочного калибра
  • Bottleneck включают выдающийся запатентованный набор из двух матриц RCBS.С этим набором вы получаете полноразмерную калибровочную матрицу, которая приводит гильзу к минимальным размерам патрона SAAMI, калибрует внешнюю часть гильзы, снимает капсюль, расширяет шейку для установки новой пули и удерживает расстояние между головками до минимальных допусков, чтобы избежать замены. длина корпуса корпуса. Эта калибровочная матрица полной длины соединена с посадочной матрицей, которая имеет заглушку для посадочной пули, а также встроенный обжимной ролик для фиксации пули во время посадки. Добавим гильзодержатель соответствующего калибра и 1000 капсюлей CCI *** :
    • .223 Remington включает в себя капсюли Small Rifle
    • Комплект Creedmoor 6.5 включает капсюли Large Rifle
    • Комплект
    • .308 Winchester включает капсюли Large Rifle

* Все продажи штампов/оболочек/праймеров являются окончательными, возврату и возмещению не подлежат. Наборы являются гарантийными, но не подлежат возврату.

** Цена каждого комплекта пистолетного капсюля/матрицы/держателя гильзы в размере 219,99 долларов США включает , предусмотренную федеральным законом  , доставку и плату за опасные вещества в размере 35 долларов США.00 за каждые 1000 праймеров. Капсюли упаковываются и отправляются отдельно наземным транспортом от комбинаций штампа и патрона.

*** Цена каждого комплекта капсюля/матрицы/держателя гильз для винтовки в размере 199,99 долларов США включает доставку в соответствии с федеральными требованиями и плату за опасные вещества в размере 35 долларов США за каждую 1000 капсюлей. Капсюли упаковываются и отправляются отдельно наземным транспортом от комбинаций штампа и патрона.

Это предложение действительно для доставки всех заказов по всему миру.США, за исключением Гавайских островов, Аляски, Массачусетса и округа Колумбия. Количество пакетов, которые вы можете приобрести, не ограничено, но за каждый отдельный пакет взимается плата за опасные вещества в размере 35 долларов США (включена в стоимость каждого пакета). Все продажи пакетов являются окончательными, не подлежат возврату и не могут быть возвращены ни частично, ни полностью ни RCBS, ни нашим розничным партнерам.

Праймеры считаются опасными материалами, облагаются сборами HazMat и могут перевозиться наземным транспортом только в пределах континентальной части США. S. Из соображений безопасности и правовых/нормативных требований комплекты грунтовки не подлежат возврату.

Дополнительные функции

  • Наборы матриц со стандартной резьбой 7/8″-14.
  • Запатентованная штамповая сталь, изготовленная в нашей штаб-квартире в Оровилле, на 100% сделанная в США.
  • Держатели гильз
  • RCBS предназначены для одноступенчатых и револьверных прессов и обеспечивают правильное выравнивание картриджа и пресс-формы.
  • Держатели гильз
  • RCBS изготовлены с соблюдением строгих допусков и закалены для многолетнего использования.
  • Держатели гильз обрезаны до глубины 0,125 дюйма для обеспечения правильного расстояния между головками.
  • Праймеры
  • CCI постоянно тестируются и совершенствуются. В результате сегодняшние капсюли CCI более чувствительны, легче устанавливаются и лучше совместимы с прогрессивным и автоматизированным загрузочным оборудованием, чем когда-либо прежде.
  • В праймерах
  • CCI используются современные неагрессивные и не содержащие ртути смеси инициаторов для максимально чистого сжигания.
  • Ограниченная пожизненная гарантия
  • RCBS распространяется на все штампы и держатели гильз.
  • Удовлетворяет большинство потребностей в перезарядке
  • Имя, которому вы можете доверять в перезарядке более 75 лет. У вас есть проблема или вопрос, позвоните нашим специалистам в Оровилле.

Primer-BLAST: инструмент для разработки целевых праймеров для полимеразной цепной реакции | BMC Bioinformatics

Пользовательский интерфейс

Интерфейс состоит из нескольких разделов, в которых пользователи могут вводить шаблон ПЦР и/или уже существующие праймеры, а также другие настраиваемые пользователем параметры (рис. 1).

Рисунок 1

Веб-интерфейс Primer-BLAST.

Пользователи могут создавать новые пары праймеров, вводя только шаблон ДНК, или они могут создавать один праймер, вводя шаблон и другой уже существующий праймер.Primer-BLAST может проверять специфичность уже существующих праймеров с матрицей или без нее. Шаблон ПЦР может представлять собой необработанную последовательность ДНК в формате FASTA или доступ NCBI. При наличии рекомендуется использовать RefSeq, так как он содержит больше информации о последовательности [15], что позволяет Primer-BLAST лучше идентифицировать шаблон и, таким образом, выполнять более качественную проверку специфичности праймера. Primer-BLAST также выполняет быструю проверку любой входной необработанной последовательности, чтобы определить, является ли она точным совпадением с последовательностью RefSeq, и в этом случае Primer-BLAST будет использовать присоединение RefSeq в качестве шаблона. Длина шаблона ограничена 50 000 баз. Для более длинных шаблонов следует использовать диапазон праймеров (правый верхний угол рисунка  1), чтобы ограничить длину.

Primer-BLAST также позволяет создавать праймеры на основе экзон/интронной структуры, чтобы ПЦР-амплификация могла быть лучше нацелена на мРНК. Пользователи могут указать, должен ли праймер охватывать соединение экзон/экзон с регулируемым количеством оснований на каждой стороне соединения, и должна ли пара праймеров охватывать интрон, а также указать размер интрона.Поскольку этот параметр зависит от точной аннотации границы экзона/экзона, требуется доступ RefSeq (в качестве шаблона ПЦР), поскольку RefSeq представляет лучшую курируемую категорию последовательностей в NCBI.

Доступно несколько вариантов баз данных для проверки специфичности с широким охватом организмов. Они включают базу данных мРНК RefSeq и базу данных генома RefSeq, которые по состоянию на 18 ноября 2011 г. содержат 226 и 7546 организмов соответственно. Эти базы данных не являются избыточными, поскольку они не содержат одни и те же области последовательностей, охватываемые более одного раза, что позволяет лучше проверять специфичность.Они являются предпочтительными базами данных для разработки новых целевых праймеров. Традиционная база данных nr, содержащая избыточные записи, также доступна и в основном рекомендуется для организмов, которые не охвачены другими базами данных, или для записей последовательностей, не охваченных базами данных RefSeq.

Primer-BLAST предлагает гибкие варианты жесткости специфичности. Пользователи могут указать количество несовпадений, которое должна иметь пара праймеров с непредусмотренными мишенями, а также 3’-концевой участок, где должны присутствовать эти несоответствия.Кроме того, пользователи могут указать пороговое значение несоответствия, выше которого любые мишени следует игнорировать (т. е. отфильтровывать мишени, имеющие слишком много несоответствий, чтобы их можно было рассматривать для неспецифической амплификации). Настройки специфичности по умолчанию таковы, что по крайней мере один праймер (для данной пары праймеров) должен иметь два или более несовпадения с непредусмотренными мишенями в последних пяти основаниях на 3′-конце, и что любые мишени с шестью или более несовпадениями по крайней мере с одним праймер (для данной пары праймеров) следует игнорировать.

Не всегда возможно создать праймеры, специфичные для конкретного сплайс-варианта мРНК, когда различия в экзонах недостаточно, чтобы отличить один от остальных.Таким образом, Primer-BLAST предлагает возможность обработки вариантов сплайсинга, которая позволяет амплифицировать другие варианты того же гена.

Другие параметры, включая параметры чувствительности поиска BLAST, свойства исключения SNP и праймера и т. д., можно найти в разделе «Дополнительные параметры».

Представление результатов

На странице результатов представлена ​​специфичность сгенерированных праймеров, графическая сводка пар праймеров по отношению к шаблону ПЦР и некоторым характеристикам, таким как экзоны, а также подробная информация о каждой паре праймеров. Он покажет только целевые праймеры, если они будут найдены; в противном случае он сообщит обо всех праймерах. Во всех случаях фактические мишени будут перечислены вместе с подробным сопоставлением между праймерами и мишенями.

В качестве примера, иллюстрирующего функциональность Primer-BLAST, мы разрабатываем праймеры с использованием транскрипта варианта 5 мРНК белка цинковых пальцев человека 419 (ZNF419) (номер доступа в Genbank NM_001098494). Как показано на рисунке  2, согласно отчету NCBI Gene существует семь вариантов транскриптов гена ZNF419.В поиске использовались значения по умолчанию, которые требуют, чтобы по крайней мере один праймер (для данной пары праймеров) имел два или более несоответствия непреднамеренным мишеням в последних пяти основаниях на 3′-конце. Проверка специфичности проводилась по базе данных мРНК NCBI RefSeq с организмом, ограниченным человеком, поскольку целью было найти пары праймеров, специфичных для этого транскрипта, только среди человеческого транскриптома. Чтобы избежать возможной амплификации геномной ДНК, выбран параметр «Праймер должен охватывать экзон-экзонное соединение».Как показано на рисунке  3, Primer-BLAST успешно возвратил пять определенных пар праймеров, и показано подробное выравнивание между мишенями и праймерами. В процессе поиска Primer-BLAST изучил в общей сложности 355 744 совпадения BLAST (см. легенду к рисунку 3), которые представляют собой не только варианты транскриптов этого гена, но и большое количество транскриптов других генов, которые в той или иной степени обнаруживают совпадения с кандидатом. грунтовки. Это подчеркивает проблему, если такое же тщательное исследование специфичности праймеров будет выполняться вручную.Среднее время поиска для создания новых праймеров с параметрами по умолчанию с использованием матрицы мРНК человека средней длины (2800-3000 оснований) составляет 2,6 минуты.

Рисунок 2

Схематическое выравнивание вариантов транскриптов мРНК гена ZNF419. Цифры обозначают конечные положения экзонов для варианта 5. Красные линии обозначают участки праймеров, выбранные с помощью Primer-BLAST. Обратите внимание, что несколько транскриптов различаются на 3 нуклеотида из-за использования немного разных сайтов сплайсинга, даже если они имеют одни и те же экзоны (т.д., вариант 2 в.с. вариант 1, вариант 7 в.с. вариант 6 и вариант 4 против вариант 3). График адаптирован из отчета NCBI по генам (http://www.ncbi.nlm.nih.gov/sites/entrez?db=gene&cmd=Retrieve&dopt=full_report&list_uids=79744. Данные получены 02.11.2011).

Рисунок 3

Пример результатов разработки целевых праймеров. Обратите внимание, что несмотря на то, что было возвращено пять пар праймеров (как показано на графике), из-за нехватки места на рисунке показаны детали только для первой пары праймеров.Ссылка «Сводка поиска» при нажатии показывает используемые параметры поиска, а также общее количество обращений BLAST, сгенерированных в процессе поиска (355 744 совпадения для текущего поиска). Числа в выравниваниях указывают начальную и конечную позиции для праймера и мишени. Точка (.) указывает на идентичность нуклеотида последовательности праймера. Поиск производился 02.11.2011.

Изучение выравнивания варианта транскрипта 5 с другими вариантами показывает, что наличие экзона 2 и отсутствие экзона 4 в сочетании являются единственными особенностями, которые отличают его от остальных (рис. 2).Неудивительно, что часть или все прямые праймеры, отобранные с помощью Primer-BLAST, расположены в экзоне 2, а все обратные праймеры находятся на стыках между экзонами 3 и 5 (поскольку экзон 4 отсутствует).

Primer-BLAST также можно использовать для проверки специфичности уже существующих праймеров. Например, мы получили праймеры для той же ПЦР-матрицы, что и выше (т. е. мРНК варианта 5 транскрипта ZNF419), из PrimerBank, который хранит множество предварительно рассчитанных геноспецифических праймеров для обнаружения мРНК [16]. Опять же, использовались параметры специфичности по умолчанию, и результат представлен на рисунке 4. В результате поиска было получено 11 236 совпадений BLAST из базы данных мРНК RefSeq с организмом, ограниченным человеческим, что еще раз иллюстрирует сложность ручной проверки результатов BLAST даже для одной пары праймеров. Эта пара праймеров действительно демонстрирует идеальное совпадение с вариантом 5 транскрипта гена ZNF419, а также с другими вариантами транскрипта того же гена и может генерировать ампликон из 444 оснований. Это согласуется с критериями отбора PrimerBank, согласно которым праймеры специфичны только на уровне генов, а не на уровне транскриптов.Интересно, что обнаруживаются и некоторые другие потенциальные ампликоны. Один из них представляет собой дополнительный ампликон из 780 оснований, присутствующий в предполагаемом транскрипте ZNF419. Другой представляет собой ампликон из 444 оснований из другого гена (т. е. белок цинкового пальца человека 773, номер доступа Genbank NM_198542.1). Однако существует до 5 несоответствий между по крайней мере одним из праймеров и мишенями, что, вероятно, достаточно для предотвращения интерференции амплификации или неспецифической амплификации. Тем не менее, пользователи могут тщательно изучить этот результат и сделать выводы на основе собственного экспериментального опыта.

Рисунок 4

Проверка специфичности уже существующих праймеров. Этот поиск был выполнен путем ввода прямого и обратного праймеров без ввода какого-либо шаблона. Праймеры (прямой праймер: GTAGGACTGCTCAGTTCAAACAT, обратный праймер: ACAGTTACTACACCCGTAAGGC) были получены из PrimerBank (http://pga.mgh.harvard.edu/primerbank/) 02.11.2011 с использованием варианта 5 транскрипта ZNF419 (номер доступа GenBank NM_001098494). Хотя результаты показали, что все 7 вариантов транскриптов гена ZNF419 имеют одинаковые ампликоны, на этом рисунке показаны подробности только для вариантов 1 и 5 из-за ограничения места.Текущий поиск сгенерировал 11 236 результатов BLAST (сделано 02.11.2011).

Сравнение с другими инструментами для проектирования грунтовки

Primer-BLAST предлагает ряд функций, недоступных в других программных инструментах. В Таблице 1 дается краткий обзор этих характеристик, многие из которых важны для различных требований к дизайну праймеров и позволяют пользователям изучить детали специфичности праймеров. Например, Primer-BLAST — это единственный инструмент, который предлагает возможность указать количество несовпадений, которое должна иметь конкретная пара праймеров с непреднамеренными мишенями, и пользовательский 3’-концевой участок, в котором должно присутствовать определенное количество несоответствий.Этот параметр важен для удовлетворения различных требований пользователей к жесткости специфичности праймеров, поскольку специфичность праймера обычно оценивается по количеству несовпадений, которые он имеет с непреднамеренными мишенями (большее количество несоответствий обеспечивает большую специфичность), и местоположениям таких несоответствий (несоответствия). ближе к 3′-концу предлагают больше специфичности). Primer-BLAST — единственная программа из трех, которая будет размещать праймеры на разных экзонах (т. е. охватывать интрон), чтобы избежать амплификации геномной ДНК, а также единственная, позволяющая настраивать количество совпадений нуклеотидов с обеих сторон соединение экзон/экзон.Кроме того, Primer-BLAST представляет подробные сведения о сопоставлении между найденными праймерами и мишенями.

Таблица 1 Сравнение выбранных функций различных инструментов проектирования праймеров

Еще одним преимуществом Primer-BLAST является его высокая чувствительность обнаружения. Как показано выше, Primer-BLAST по умолчанию способен обнаруживать потенциальные мишени для амплификации, которые имеют до 5 несовпадений с праймером. Primer-Blast достигает этого результата, используя высокочувствительные параметры BLAST, а также дополнительный алгоритм глобального выравнивания NW для обеспечения полного выравнивания между праймером и его целью.Однако одно предостережение заключается в том, что алгоритм BLAST [6] требует минимального совпадения нуклеотидов (размера слова) между запросом и целью, и любые инструменты, использующие BLAST в качестве алгоритма поиска, подвержены этому ограничению. Следовательно, Primer-BLAST (с параметрами по умолчанию) пропустит любые цели, которые имеют 6 или менее последовательных совпадений с праймером (поскольку Primer-BLAST по умолчанию использует размер слова 7). Например, если у мишени есть несовпадения с праймером из 20 оснований в позициях 7 и 14 (при условии, что 5′-конец является первой позицией), мишень будет пропущена Primer-BLAST (с параметрами по умолчанию), даже если она имеет только 2 несоответствия.Предполагая случайное распределение местоположений несоответствия, можно рассчитать количество возможных расположений из 18 совпадений и 2 несовпадений. Существует 20*19 различных способов разместить 2 несовпадения среди 18 совпадений, но только 2 из них приводят к размеру слова меньше 7, поэтому вероятность пропуска цели с 2 несовпадениями с праймером из 20 оснований равна 2/ (20*19) или примерно 0,5%.

Далее мы сравним чувствительность обнаружения цели между Primer-BLAST и другими инструментами для разработки праймеров, такими как QuantPrime и PRIMEGENS. В идеале сравнение чувствительности обнаружения должно заключаться в непосредственном тестировании модулей проверки специфичности во всех инструментах с использованием праймеров, созданных третьей стороной (например, праймеров, созданных Primer3). К сожалению, эта опция недоступна, поскольку Primer-BLAST — единственный инструмент, предлагающий прямую проверку специфичности (т. е. проверку специфичности уже существующих праймеров). В качестве альтернативы мы использовали QuantPrime и PRIMEGENS для разработки целевых праймеров, а затем использовали Primer-BLAST для проверки этих праймеров на наличие потенциальных мишеней.Если Primer-BLAST не находит мишеней, отличных от намеченной (т. е. саму вводимую матрицу мРНК), то можно сделать вывод, что QuantPrime и PRIMEGENS по крайней мере так же чувствительны, как Primer-BLAST. С другой стороны, наличие непреднамеренных целей, обнаруженных Primer-BLAST, указывает на то, что эти инструменты не так чувствительны, как Primer-BLAST в отношении чувствительности обнаружения целей (поскольку эти инструменты уже исследовали такие цели, но не могли избежать их во время их выбора). процессы для целевых праймеров).

Тестовые шаблоны выбираются случайным образом из базы данных мРНК NCBI Refseq и включают 52 последовательности человека для тестирования QuantPrime и 24 последовательности Arabidopsis thaliana для тестирования PRIMEGENS (поскольку PRIMEGENS не поддерживает последовательности человека). Как показано в Таблице 2, QuantPrime или PRIMEGENS создали пары праймеров для большинства тестовых случаев, которые они считали специфичными для входных шаблонов. Однако Primer-BLAST показал, что многие из них (13,4% пар праймеров из QuantPrime и 43,3% пар праймеров из PRIMEGENS) имеют потенциальные непреднамеренные мишени, которые демонстрируют несовпадение от одного до пяти нуклеотидов.В результате большая часть тестовых случаев содержит по крайней мере одну пару праймеров с потенциальными непреднамеренными мишенями (31,5% для QuantPrime и 93,3% для PRIMEGENS). Некоторые мишени имеют только одно или два несовпадения с праймерами, полученными из QuantPrime (18,5%), хотя эта часть намного меньше для PRIMEGENS (3,4%).

Таблица 2 Сводка потенциальных непреднамеренных целей для пар праймеров, о которых сообщают QuantPrime и PRIMEGENES a

На рис. 5 показаны подробности для 5 потенциальных непреднамеренных целей.Например, QuantPrime создает две пары праймеров (пример 1 и 2), которые разработаны специально для образцов Genbank NM_182690.2 и NM_001039567.2 соответственно (рис. 5). Однако Primer-BLAST показывает, что эти две пары имеют потенциальные непреднамеренные мишени, NM_005227.2 и NM_001008.3 соответственно, которые имеют только одно несоответствие нуклеотида с прямым или обратным праймером. Пара праймеров, созданная с помощью PRIMEGENS (пример 4), также показывает потенциальную непреднамеренную мишень только с одним несовпадением.Как было рассмотрено ранее, несоответствие одного нуклеотида (даже на 3’-конце) не оказывает существенного влияния на амплификацию мишени, и поэтому эти пары праймеров вряд ли будут специфичными для предполагаемых мишеней. Неспособность обнаружить несоответствие одного основания на (нуклеотидное основание G в примере 1) или вблизи 3′-конца (нуклеотидное основание C в примере 2) свидетельствует о недостатке использования только алгоритма локального выравнивания. Локальное выравнивание пытается максимизировать возвращаемую им оценку, поэтому оно не будет включать несоответствия в конце или (возможно) ближе к концу выравнивания, поскольку они уменьшат общую оценку [6].Другие случаи непреднамеренных мишеней включают 2 несовпадения (пример 3) или 5 несовпадений (пример 5) с одним из праймеров.

Рисунок 5

Примеры потенциальных непреднамеренных мишеней для пар праймеров, сгенерированных QuantPrime и PRIMEGENS. Примеры мишеней извлечены из результатов проверки специфичности Primer-BLAST для пар праймеров, созданных с помощью QuantPrime или PRIMEGENS (всего для QuantPrime и PRIMEGENS было идентифицировано 162 и 116 потенциальных непреднамеренных мишеней соответственно. Подробности см. в Таблице  2). Примеры праймеров соответствуют праймерам, подчеркнутым в дополнительных файлах 1 и 2.

Таким образом, мы заключаем, что Primer-BLAST способен обнаруживать потенциальные непреднамеренные мишени, которые пропускаются QuantPrime или PRIMERGENS в процессе скрининга специфичности.

Инструмент для создания праймеров

Выбор экзона/интрона Последовательность мРНК refseq в качестве ввода шаблона ПЦР требуется для опций в разделе Справка

Последовательность мРНК refseq (например, запись последовательности entrez, номер которой начинается с NM_) позволяет программе правильно идентифицировать соответствующую геномную ДНК и, таким образом, находить правильные границы экзона/интрона.

Расстояние между экзонами PreferencePrimer не должен охватывать соединение экзон-экзон. Primer не может охватывать соединение экзон-экзон. Справка

Это определяет, должен ли праймер охватывать соединение экзона на вашей матрице мРНК. Параметр «Праймер должен охватывать соединение экзон-экзон» указывает программе возвращать по крайней мере один праймер (в заданной паре праймеров), который охватывает соединение экзон-экзон.Это полезно для ограничения усиления только мРНК. Вы также можете исключить такие праймеры, если хотите амплифицировать мРНК, а также соответствующую геномную ДНК.

Соответствие соединения экзонов

Мин. 5′ матч Мин. 3′ матч Матч до 3 футов

Минимальное и максимальное количество оснований, которые должны отжигаться с экзонами на 5′- или 3′-стороне соединения Справка

Это определяет минимальное количество оснований, которое праймер должен отжигать с шаблоном на 5′-стороне (т. е., к началу праймера) или к 3′-стороне (т. е. к концу праймера) экзон-экзонного соединения. Отжиг обоих экзонов необходим, так как это обеспечивает отжиг области экзон-экзонного соединения, а не только экзона. Обратите внимание, что этот параметр эффективен только в том случае, если вы выбрали «Праймер должен охватывать соединение экзон-экзон» для параметра «Промежуток соединения экзона».

Включение интрона Диапазон длины интрона Параметры проверки специфичности пары праймеров Проверка специфичности Режим поиска Автоматически с руководством пользователяБез руководства пользователя Справка

Primer-blast пытается найти целевые праймеры, помещая праймеры-кандидаты в уникальные области матрицы, которые не похожи на другие мишени. Однако в некоторых случаях Primer-blast не может определить, является ли последовательность базы данных предполагаемой целью или нет, поэтому руководство пользователя может быть полезным (например, когда ваш шаблон представляет собой полиморфную форму или частичную область записи в поиске). базы данных или когда база данных, такая как nr, содержит избыточные записи вашего шаблона).
Параметр «Автоматически» будет запрашивать указания пользователя только в том случае, если программа не находит достаточного количества уникальных областей шаблона, в то время как параметр «Управляемый пользователем» всегда будет запрашивать указания пользователя, если ваш шаблон демонстрирует высокое сходство с любыми другими последовательностями базы данных.

База данных Репрезентативные геномы RefseqРепрезентативные геномы RefseqГеномы для выбранных организмов (только первичная эталонная сборка)РНК nrRefseq (refseq_rna)Пользовательский Справка

Рефсек мРНК:
&nbsp&nbsp&nbsp Содержит мРНК только из коллекции эталонных последовательностей NCBI

Репрезентативные геномы Refseq:
&nbsp&nbsp&nbsp Эта база данных содержит эталонные и репрезентативные геномы NCBI RefSeq по широким таксономическим группам, включая эукариоты, бактерии, археи, вирусы и вироиды. Эти геномы являются одними из самых качественных геномов, доступных в NCBI. Эта база данных содержит минимальную избыточность в представлении генома. Для эукариот для каждого вида включен только один геном (однако при необходимости включены альтернативные локусы эукариотических геномов). Для других видов могут быть включены геномы различных изолятов одного и того же вида. Геномы митохондрий включены там, где это применимо.

Refseq РНК:
&nbsp&nbsp&nbsp Содержит все записи РНК из коллекции эталонных последовательностей NCBI

Геномы для выбранных организмов (только первичная эталонная сборка):
&nbsp&nbsp&nbspЭто полные или почти полные последовательности генома из первичных хромосомных наборов (т.е., без митохондрий или альтернативных локусов) для следующих выбранных организмов:

& NBSP & NBSP & nbspapis MELLIFERA
& NBSP & NBSP & nbspbos Taurus
& NBSP & NBSP & nbspdanio rerio
& NBSP & NBSP & nbspdog
& NBSP & NBSP & nbspdrosophila MELANOGASTER
& NBSP & NBSP & nbspgallus Gallus
& NBSP & NBSP & nbsphuman
& NBSP & NBSP & nbspmouse
& NBSP & NBSP & nbsppan троглодиты
& NBSP & NBSP & nbsppig
& NBSP & NBSP & nbsprat

Хотя последовательности в этой базе данных полностью покрыты базы данных представительные геномов RefSeq, он не содержит альтернативных локусов и, следовательно, имеет даже меньшую избыточность, чем база данных репрезентативных геномов Refseq. Эта база данных рекомендуется, если вас не беспокоит отсутствие альтернативных локусов или последовательностей митохондрий.

Пользовательский:
&nbsp&nbsp&nbspВы можете использовать свои собственные последовательности (инвентарный номер, gi или последовательность FASTA) в качестве базы данных поиска. Размер базы данных ограничен 300M.

Строгость специфичности праймера Праймер должен иметь не менее 123456 всего несоответствий по непреднамеренным целям, в том числе
как минимум 123456 несоответствия в течение последнего 1 2 3456 78910111213141516171819202122 бит/с на 3′-конце. Справка

Для этого требуется, чтобы по крайней мере один праймер (для данной пары праймеров) имел указанное количество несовпадений с непреднамеренными мишенями. Чем больше несоответствий (особенно ближе к 3′-концу) между праймерами и непреднамеренными мишенями, тем более специфична пара праймеров для вашего шаблона (т. е. будет труднее отжигать непреднамеренные мишени). Однако указание большего значения несоответствия может затруднить поиск таких конкретных праймеров.В таком случае попробуйте уменьшить значение несоответствия.


Игнорировать цели, которые 123456789 или более несовпадений с праймером. Справка

Это еще один параметр, который можно использовать для корректировки строгости специфичности праймера. Если общее количество несовпадений между мишенью и хотя бы одним праймером (для данной пары праймеров) равно или превышает указанное число (независимо от местоположения несовпадения), то любые такие мишени будут проигнорированы при проверке специфичности праймера.Например, если вас интересуют только мишени, идеально соответствующие праймерам, вы можете установить значение 1. Вы также можете уменьшить значение E (см. дополнительные параметры) в таком случае, чтобы ускорить поиск, поскольку высокое значение E по умолчанию не требуется для обнаружения мишеней с небольшим количеством несовпадений с праймерами.
Кроме того, эта программа имеет ограничение на обнаружение мишеней, которые слишком отличаются от праймеров… она будет обнаруживать мишени, которые имеют до 35% несовпадений с последовательностями праймеров (т. е. всего 7 несовпадений для 20-мерного).
Возможно, вам придется выбрать более чувствительные параметры взрыва (в расширенных параметрах), если вы хотите обнаруживать цели с большим количеством несоответствий, чем по умолчанию.


Максимальный размер целевого ампликона Разрешить варианты соединения

ПраймерБанк


Поиск праймеров для ПЦР Здесь вы можете сравнить свою последовательность с базой данных последовательности праймербанка.
Заказать Oligos

Вы можете заказать синтез праймеров и секвенирование продуктов реакции ПЦР по адресу:



PrimerBank — общедоступный ресурс праймеров для ПЦР. Эти праймеры предназначены для обнаружения или количественного определения экспрессии генов (ПЦР в реальном времени). PrimerBank содержит более 306 800 праймеров, охватывающих большинство известных генов человека и мыши. Существует несколько способов поиска праймеров: доступ к GenBank, доступ к белку NCBI, идентификатор гена NCBI, символ гена Новинка! , идентификатор PrimerBank или ключевое слово (описание гена), или вы можете взорвать последовательность гена против базы данных последовательностей праймербанка Новинка! .

Алгоритм разработки праймеров был тщательно протестирован в ходе экспериментов ПЦР в реальном времени на предмет специфичности и эффективности ПЦР. Мы протестировали 26 855 пар праймеров, которые соответствуют 27 681 гену мыши, с помощью ПЦР в реальном времени с последующим электрофорезом в агарозном геле и секвенированием продуктов ПЦР. Показатель успеха дизайна составляет 82,6% (22 187 успешных пар праймеров) на основе электрофореза в агарозном геле.

Все данные экспериментальной проверки праймеров для мышей доступны в PrimerBank. Для просмотра перейдите по соответствующим ссылкам на информационной странице.


Публикация:

Xiaowei Wang, Athanasia Spandidos, Huajun Wang и Brian Seed: PrimerBank: база данных праймеров для ПЦР для количественного анализа экспрессии генов, обновление 2012 г.
Нукл. Кислоты рез. (2012) 40 (Д1): Д1144-9.

Athanasia Spandidos, Xiaowei Wang, Huajun Wang и Brian Seed: PrimerBank: ресурс пар праймеров для ПЦР человека и мыши для обнаружения и количественного определения экспрессии генов
Nucleic Acids Research 2010 38:D792-9.

Athanasia Spandidos, Xiaowei Wang, Huajun Wang, Stefan Dragnev, Tara Thurber и Brian Seed: обширная коллекция экспериментально проверенных праймеров для количественного определения количества транскриптов мышей с помощью полимеразной цепной реакции.
BMC Genomics 2008, 9:633

Xiaowei Wang and Brian Seed: банк праймеров для ПЦР для количественного анализа экспрессии генов.
Nucleic Acids Research 2003 31(24): e154; стр.1-8.

Грунтовка приема данных — Сеть курирования данных

90 256
Acrobat PDF Premer Создатели: Мир Оссом-Уильямсон, Николь Контаксис, Маргарет Лам и Адам Крисберг
наставник: Джейк Карлсон
Атлас.Ti Primer Создатель: Margarita Corral
Atherified Участник: Hannah Hadley
Mentor: Dave Gadley
Создатель Создатель: Сьюзен Айви, Эми Кошоффер, Гретхен Снефф и Хуайин Ван
Наставник: Лиза Джонстон
Согласие Формы Primer Авторы: Shanda Hunt, Алисия Hofelich Мор и Rachel Woodbrook
Базы данных Primer Создатель: Xuying Xin
Mentor: Dave Ферон
геоданных Primer Создатель: Эндрю Баттиста, Том Бритначер, Зеноби Гаррет, Дженнифер Мур и Кэрри Пирманн
наставник: Мара Блейк
Geojson Primer Создатели: Надя Дикссон, Женевьева Милликен, Кешав Мукунда, Рейна Мюррея и Рэйчел Звездный
Наставник: Мара Блейк
GeoTIFF Primer Создатели: Кортни Кирни, Ник Рус, Мара Седлинс, Трейси Тьен, Джессика Трелоган и Джон Уоттс
Наставник: Дженнифер Мур HESS
Участники человека Data Essentials Primer Создатели: Джен Дарраг, Алисия Хофелич МОР, Шанда Дженство, Рэйчел Вудбрук, Дэйвский Турист, Дженнифер Мур и Ханна Хадли
ISO ISO Promer Создатель: Kate Barron и Jonathan Bohan
Mentor: Cynthia Hudson Vitale
Создатели: Daina Boukin, Софи Хоу, Мэтью Борда и Ли Уилсон
Mattor: Susan Borda
Создатели: Сэм Шолла и Сьюзан Борда
Microsoft Access Primer Создатели: Fernando Rios
Mentor: Dave Gronon
Создатель: Грег Янё, Сандра Саучук и Хо Джун Юнг
Наставник: Wendy Kozlowski
Neuroimaging DICOM и Nifti Primer Создатели: Майкл Мур, Брэндон Паттерсон, Сара Самуэль, Хеленмари Шеридан, Крис Соренсен
Наставник: Джоэл Херндон
netCDF Primer и учебник с использованием набора данных NCAR
NVivo Primer Создатель: Ханна Хэдли
Партнер: Маргарита Коррал
Ментор: Дэйв ФиронA. Pryse, Matthew Harp, Sara Mannheimer, Wanda Marsolek и Wind Cowles
Marsolek: Lisa Johnston
Качественные данные Primer Создатели: Диана Кастильо, Хизер, Микала Нарлок
Mentor: Shanda Hunt
R Primer Создатели: Линда Келлам, Кэтрин Козиар и Станислав Pejša
наставник: Joel Herndon
SPSS Primer Создатель: Саи Дэн, Джошуа Тут, Джинан Финн и Шахира Khair
Mentor: София Лаффон Hess
СТЛ Primer Авторы: Элизабет Blackwood, Даг Жубер и Джеймс Sobczak
Mentor: Дженнифер Мур
SAS Primer Создатель: Цюн Сюй
Mentor: Джен Дарраг
Tableau Primer Создатели: Кристин Малиновски и Триша Адамус
Наставник: Венди Козловски
Twitter Primer Создатели: Марли Кальт и Доррис Скотт
Наставник: Венди Козловски
WordPress. com Primer Создатель: Хизер Джеймс
Наставник: Лиза Джонстон

DNASeq — Primers

Центр секвенирования ДНК UC бесплатно предоставляет следующие универсальные праймеры: Взгляните на наши новые универсальные праймеры!!

Грунтовка Последовательность

M13F(-21)

5′ GTAAAACGACGGCCAGT 3′

М13Р

5′ КАГГАААКАГТАТГАЧ 3′

Т7пром

5′ TAATACGACTCACTATAGGG 3′

Т7терм

5′ GCTAGTTATTGCTCAGCGG 3′

Т3пром

5′ ATTAACCCTCACTAAAG 3′

СП6

5′ ГАТТТАГГТГААКАКТАТАГ 3′

ЦМВ-Ф

5′ CGCAAATGGGCGGTAGGCGTG 3′

CMV-R

5′ AGTAGGAAAGTCCCGTAAGG 3′

БГХ-Р

5′ TAGAAGGCACAGTCGAGG 3′

пБАД-Ф

5′ ATGCCATAGCATTTTTATCC 3′

пБАД-Р

5′ ГАТТТААТКТГТАТКАГГ 3′

pGEX5′

5′ GGGCTGGCAAGCCACGTTTGGTG 3′

pGEX3′

5′ CCGGGAGCTGCATGTGTCAGAGG 3′

Если вы разрабатываете свой собственный праймер для секвенирования, убедитесь, что вы используете программу создания праймеров, чтобы избежать множественных участков отжига, праймеров-димеров и т. д.Имейте в виду, что праймеры для ПЦР не всегда подходят для секвенирования, поскольку циклическое секвенирование является гораздо более строгим протоколом, чем ПЦР. Пожалуйста, посетите нашу страницу часто задаваемых вопросов для более подробной информации. Вот несколько рекомендаций по разработке собственного праймера для секвенирования:

  • Праймеры должны иметь длину не менее 18 оснований, чтобы обеспечить хорошую гибридизацию с матричной ДНК.
  • Избегайте серий идентичных нуклеотидов, особенно серий с 4 или более G.
  • Содержание G/C должно быть в пределах 30-80%, предпочтительно в пределах 50-55%.
  • Для реакций циклического секвенирования праймеры с Tm в пределах 50–70°C дают лучшие результаты, чем праймеры за пределами этого диапазона.
  • Для праймеров с содержанием G/C менее 50% может потребоваться удлинение последовательности праймеров за пределы 18 оснований, чтобы поддерживать Tm на достаточно высоком уровне.
  • Избегайте праймеров, которые могут гибридизоваться с образованием димеров.
  • Избегайте палиндромов, поскольку они могут образовывать вторичные структуры.
  • Праймеры должны быть обессолены и очищены в соответствии с отраслевыми стандартами.

Образец выпускаемого обновления 7 октября 2021 г.:

Кампус Калифорнийского университета в Дэвисе снова открылся, и двери в Сторер Холл теперь открыты. Однако из-за нехватки персонала и объемов выборки на данный момент мы используем тот же график и процедуры сдачи образцов, которые применялись с начала пандемии (см. информацию ниже).Единственным исключением является то, что вы также можете оставить свои образцы в одной из белых корзин на стене рядом с доской за пределами лаборатории по адресу 0208 Storer Hall. Мы продолжим оценивать расписание и надеемся внести изменения в ближайшем будущем.

Мы получаем образцы секвенирования ДНК и анализ фрагментов в определенное время и в определенные дни. Прогоны и время обработки данных будут варьироваться в зависимости от объема выборки. В настоящее время срок выполнения составляет примерно 2-3 дня.

График сдачи образцов ДНК:

Storer Hall: пн, ср и пт до 12:00 в конверте, приклеенном скотчем к входным дверям, или в корзинах снаружи лаборатории

Приложение VM3B: пн, ср и пт до 11:00 (если вы хотите, чтобы образцы были готовы в тот же день) или в любой другой день с понедельника по пятницу в рабочее время

UCDMC: Только по запросу

Если этот график вам не подходит, свяжитесь с нами по адресу [email protected], и мы договоримся о другом времени, когда вы сможете сдать свои образцы.

Пример инструкции по сдаче:

Для доставки в Storer Hall поместите свои образцы в чистый пакет Ziploc с номером вашего заказа, отправьте их в конверте в запланированное время доставки MWF до 12:00 и отправьте электронное письмо по адресу [email protected] edu, чтобы сообщить, что они там. Вы также можете оставить их в корзинах возле нашей лаборатории MWF до 12 часов дня.

Для сдачи пристройки VM3B дверь теперь открыта в рабочее время с понедельника по пятницу, поэтому вы можете сдать образцы в любой день недели.Мы будем забирать образцы по понедельникам, средам и пятницам в 11:00.

Если у вас есть 96-луночный планшет или образцы для анализа фрагментов, вы можете оставить свои образцы в корзинах за пределами лаборатории.

Чтобы свести к минимуму любое воздействие, проявите осторожность и воздержитесь от размещения заказов, если вы или кто-либо в вашей лаборатории недавно заболел.

Инструкции по отправке:

Наш приемный отдел работает с понедельника по пятницу, поэтому вы можете отправить нам товар в любой день недели.Пожалуйста, напишите [email protected], чтобы сообщить нам, сколько образцов вы будете отправлять и когда.

Благодарность от сотрудников отдела секвенирования UCDNA

Праймеры, макияж и многое другое без жестокости

Smashbox: Праймеры, макияж и многое другое без жестокости стрелка—значок внизстрелка-значок вверхстрелка-длинный-l значокстрелка-длинный-r значокзначок автопополнениязначок сумкизначок камерыкамера-утолщенный значоккамеразначок—значок внизкаретка—левый значоккаретка—значок вправо-значок вверхкаретка-тонкий—левый значоккаре- тонкая—правая иконка-тонкая-белая-левая иконка-тонкая-белая-правая иконка-с-bg—левая иконка-с-bg—правая иконка-с-bg-полупрозрачная—левая иконка- с-bg-полупрозрачный—правый значоккаретка-с-bg-полупрозрачный-белый—левый значок-с-bg-полупрозрачный-белый—правый значок-с-bg-белый—левый значок- with-bg-white—right iconcart iconchat iconCreated by Ragal Kartidev from the Noun Projectcheckbox—checked iconcheckbox iconcircle-caret—left iconcircle-caret—right iconcircle-filled iconcircle-next iconcircle-outline iconcircle-prev iconclose-inverted iconclose- значок xзначок закрытиязначок электронной почтызначок facebookзначок гамбургераголова—значок контураголова—значок сплошнойсердце—выбранный значокзначок сердцазначок instagramзначок livechat-контур значокзначок livechatlocation—заполненный значокзначок местоположения-поискаloca значок логотипазначок карты-маркераминус—жирный значокминус значоктелефонpinterest—круг значокpinterestплюс—жирный значокплюсзначок вопросарадио—отмеченный значокзначок радиозначок поисказначок социального-fbзначок социального-instagramзначок социального-pinterestзначок социального-твиттеразначок социального-youtubeзначок звездытреугольник-вниз значоктреугольник-слева значоктреугольник-справа значоктреугольник-значок вверхзначок Twitterвидео-кнопка воспроизведения—черный значоквидео-кнопка-воспроизведения—белый значокзначок видео-воспроизведениязначок vkx-нижний значокx-верхний значокxo значокyoutube—играть значокзначок youtube {{/ изображение }} {{# заглавие }} {{/ заглавие }} {{# описание }}

{{{ описание }}}

{{/ описание }} {{# ссылка_текст }} {{/ link_text }} {{# название }}

{{{ название }}}

{{/ название }} {{# описание }}

{{{ описание }}}

{{/ описание }} {{# ссылка_текст }} {{/ link_text }} .

Добавить комментарий

Ваш адрес email не будет опубликован.